Knockout Cell Lines

Locate My Expert
Knockout Cell Lines

 

Generation of knockout (KO) cell line models with a loss-of-function mutation is an important method for studying the function of given genes. Compared with traditional gene interference (RNAi) technology, gene knockout (KO) models allow researchers to fully disrupt expression of the target gene, ultimately leading to either complete non-expression or loss of function in proteins. Gene knockout (KO) cell lines enable researchers to study the role of specific genes by comparing the phenotypic differences among the knockout and wildtype cells.

 

The generation of gene knockout cell lines can be time-consuming and complicated, especially for researchers unfamiliar with the process. Oftentimes, scientists may spend 3-4 months attempting to generate a custom cell line, but end up with an incomplete knockout upon genotyping – significantly setting back research progress.

 

Cyagen Knockout Cell Line Service

Cyagen’s Smart-CRISPR™ cell line modeling services enable large fragment excision or accurate mutation(s) – providing knockout cell lines with complete loss-of-function of the target gene.

Our custom cell line modeling services platform features CRISPR-mediated gene editing that is optimally targeted with our proprietary artificial intelligence (AI)-based AlphaKnockout Smart Gene Targeting System - enabling higher knockout (KO) efficiency. We can perform multiple knockout strategies, including frameshift mutation, large fragment knockout, and multiple genes knockout. With CRISPR/Cas9 technology, researchers can easily solve the problem of residual protein expression seen in RNA interference (RNAi) gene knockdown models.

Our experts have generated 1,000+ cell line models - Cyagen can rapidly generate knockout cell lines for your research in as fast as 7 weeks using our highly efficient Smart-CRISPR™ platform.

 

Highlight Features

Knockout Modification Strategies

We can perform a variety of knockout (KO) strategies to generate a custom cell line model, including frameshift mutation, large fragment knockout, and multiple genes knockout. We will adopt the best knockout strategy to greatly improve the success rate of target gene knockout and the expression efficiency according to each project's unique requirements.

 

Short Timeline

The unique combination of our highly efficient CRISPR-based technology platform along with extensive experience allows for rapid knockout cell line model generation, up to 2-3 weeks shorter than the conventional timeline.

Customized Deliverables

Upon request, we can deliver homozygous, heterozygous, or negative clones. We can additionally provide professional experiment reports and quality inspection reports.

 

Cyagen Cell Line Generation Platform Advantages

  • Efficient Smart-CRISPR Technology: Allows for multiple knock-out strategies, higher gene editing efficiency, and ensuring protein complete non-expression to the greatest extent.
  • Superior Customer Support: VIP project specialist is available for project follow-up and progress reporting support.
  • Quality Control: Thorough validation and testing are performed to ensure that the cell line model meets your requirements.
  • Extensive Experience: Over 1,000 cell models successfully generated, receiving over 100 peer-reviewed citations thus far.
  • One-stop Solution: Cyagen offers comprehensive solutions for both in vivo and in vitro studies, from gene expression regulation and gene function verification across various cells, to establishment of mouse or rat models, as well as downstream phenotypic analysis.

 

Featured Cell Lines (Successfully Generated)

Classification Cell Line Name Abbreviation

Blood and lymphatic system

Mouse monocyte macrophage leukemia cells

RAW 264.7

Human B lymphoblasts

HMy2.CIR

Human T lymphocyte leukemia cells

HuT 78

Human monocytic leukemia

THP-1

Human chronic myeloid leukemia cells

K-562

Human promyelocytic leukemia cells

HL-60

Human leukemia T lymphocyte

Jurkat, Clone E6-1

Bone and skin system

Mouse melanoma cells

B16

Mouse skin melanoma cells

B16-F10

Human osteosarcoma cells

U-2 OS

Human malignant melanoma cells

A375

Human fibrosarcoma cells

HT-1080

Digestive system

Mouse colon cancer cells

CT26.WT

Human ileocecal carcinoma cells

HCT-8

Human colon cancer cell

HCT 116

HT-29

Human colon adenocarcinoma cells

SW480

Human colorectal cancer cells

LoVo

Human esophageal squamous cell carcinoma cells

KYSE-150

Human gastric cancer cells

HGC-27

Respiratory system

Mouse lung cancer cells

LLC

Hamster lung cells

V79

Human normal lung epithelial cells

BEAS-2B

Large cell lung cancer cell

NCI-H460

Human on-small-cell lung carcinoma

NCI-H1299

A549

Human lung squamous cell carcinoma cells

SK-MES-1

NCI-H520

Urinary system

Mouse glomerular mesangial cells

SV40 MES 13

Rat adrenal pheochromocytoma cells

PC-12

Rat renal cells

NRK

African green monkey kidney cells

Vero

Rhesus monkey kidney cells

LLC-MK2

Human bladder cancer cells

5637

Human prostate cancer cells

PC-3

Human embryonic kidney cells

293 Cells, low passage

Human renal cell adenocarcinoma cells

786-O

ACHN

Brain and nervous system

Mouse pituitary tumor cells

AtT-20

Rat glioma cells

C6

Human glioma cells

U251

Human neuroblastoma cells

SK-N-SH

Endocrine system

Mouse breast cancer cells

4T1

Human breast cancer cells

MCF-7

MDA-MB-231

Reproductive system

Hamster ovary cell subline

CHO-K1

Human cervical cancer cells

Hela

Human ovarian cancer cells

SK-OV-3

Circulatory system

Mouse myoblasts

C2C12

Rat myoblasts

L6

Rat cardiomyocytes

H9c2(2-1)

 

Successful Case Study - Knockout Cell Line

Project: Human HCT116 cell PSME3 gene knockout (fragment deletion)

1. gRNA Design

gRNA Site 1: ATACGCTACCTAACATGGCTGGG;

gRNA Site 2: CCAGCATGCAAAATACAATGGGG

2. Primer Synthesis and Plasmid Construction

3. Cell Transfection

Firstly, confirm the optimal electroporation parameters, then transfect the vector into cells by electroporation.

4. Single Cell Clone Screening and Culture

5. PCR and Electrophoresis Identification

Identification Strategy:

6. Sequencing Identification

ATAAACAGAGGATTTAAGACTTTTGTTATGTTTTAGACGC-del;

1809bp--AGTGGCTAATGCCT GTAATCC CACCACTTTGGGAGGCCAA