1. Home
  2. Community
  3. Promotions
  4. Limited Time Offer, Knockout Cell Lines Only $5,599

Limited Time Offer: Knockout Cell Lines Only $5,599
Custom Cell Line Generation - 100% money back guarantee
Knockout Cell Lines
Knockin Cell Lines
Point Mutation Cell Lines
Overexpression Cell Lines
Request a Consultation

For a limited time, get your knockout cell line for only $5,599.

Eligible Service Promotional Price Deliverables
Knockout cell lines $5,599 ● Homozygous clones, two cryovials per clone (1*106 cells/ vial).
● Cell Quality Report
● Positive clones Identification Report
Cell Line Generation Successful Cases

Project: Human HCT116 cell PSME3 gene knockout (fragment deletion)

1. gRNA Design

gRNA Site 1: ATACGCTACCTAACATGGCTGGG;
gRNA Site 2: CCAGCATGCAAAATACAATGGGG

2. Primer Synthesis and Plasmid Construction

3. Cell Transfection

Firstly, confirm the optimal electroporation parameters, then transfect the vector into cells by electroporation.

4. Single Cell Clone Screening and Culture
5. PCR and Electrophoresis Identification

Identification Strategy:

6. Sequencing Identification

ATAAACAGAGGATTTAAGACTTTTGTTATGTTTTAGACGC-del;
1809bp--AGTGGCTAATGCCT GTAATCC CACCACTTTGGGAGGCCAA

Custom Cell Line Generation Capabilities

It is well known that cell lines play an important role in gene function studies, drug screening, and the production of recombinant proteins and antibodies. However, generating a gene knockout cell line model is a time-consuming and laborious process. Partnering with Cyagen for your cell line model projects ensures that your research model is developed appropriately.

  • Knockout Cell Lines

    We can perform a variety of knockout (KO) strategies to generate a custom cell line model, including frameshift mutation, large fragment knockout (LFKO), and multiple genes knockout to optimize the success rate of targeted gene knockout. Compared with traditional gene interference (RNAi) technology, gene knockout (KO) models allow researchers to fully disrupt expression of the target gene, ultimately leading to either complete non-expression or loss of function in proteins. Gene knockout (KO) cell lines enable researchers to study the role of specific genes by comparing the phenotypic differences among the knockout and wildtype cells.

    >> Learn More
  • Knockin Cell Lines

    Knockin defined as an exogenous gene inserted in a native locus of interest. A double stranded break is introduced by CRISPR-Cas9 to a specific site in the genome. Via homology-directed repair pathway, the donor sequence alone with homologous arms can be introduced into that locus. CRISPR-Pro technology enables large fragment knockin in variety of mammalian cell lines.

    >> Learn More
  • Point Mutation Cell Lines

    Point mutation defined as one or more nucleotides are mutated. The insertion, deletion, nonsense and sense mutations alter the amino acid sequence, thus changing its functions or properties of a given protein. Point mutation knockin cell lines enable a clear understanding of the contribution of the mutation to a phenotype.

    >> Learn More
  • Overexpression Cell Lines

    Stable cell lines are crucial laboratory tools. Gene overexpression, inducible gene expression, gene knockout, gene knockdown all can be achieved by custom lentiviral-based stable cell line service.

    >> Learn More
Related Services
  • Cell Function Testing

    Cyagen provides various cell function testing services, including transwell invasion, cell migration, cell cycle, cell proliferation, cell apoptosis, and other cell detection assays that can be realized by the flow cytometry platform. We assure the standardization, accuracy, and reliability across the entire process, from strategy design through sample preparation and data analysis.

    >> Learn More
Custom Cell Line Generation Resource
  • Cyagen Exclusive White Paper
    Application of CRISPR/Cas-based Technology to Create Knockout Cell Lines
    Download Your Copy >>
  • Exclusive Handbook
    Frequently Asked Questions on Cell Line Generation
    Download Your Copy >>
  • Technical Bulletin
    What are Knockout Cell Lines Used For?
    Discover More >>
  • Technical Bulletin
    How to Effectively Generate CRISPR Gene Knockout Cell Lines? Choosing a Transfection Method
    Discover More >>
Custom Research Model Expert Support

Cyagen offers a "one-stop shop" tailored to your gene research needs. We offer a customized service, starting with vector construction, virus packaging to custom cell line generation and stable cell line generation. All projects are fully customizable and flexible.

Cyagen’s top-quality services are backed by our industry-best 100% money-back guarantee. We always provide free consultations and strategy designs from our team of PhD scientists that boast several decades of collective experience in the field.

  • Have a question? We can offer complete solutions to your research challenges.
  • Want more information? We provide all kind of supporting resource such as case study,white paper for your reference.
  • ls your project ready to go? Request a quote.

Complete the form tell us more about your research needs >>

Request Expert Support
Please tell us more about your project needs.
click to refresh