Limited Time Offer, Knockout Cell Lines Only $5,599

For a limited time, get your knockout cell line for only $5,599.

Project: Human HCT116 cell PSME3 gene knockout (fragment deletion)

1. Guide Molecule Design

Guide Molecule Site 1: ATACGCTACCTAACATGGCTGGG；
Guide Molecule Site 2: CCAGCATGCAAAATACAATGGGG

2. Primer Synthesis and Plasmid Construction

3. Cell Transfection

Firstly, confirm the optimal electroporation parameters, then transfect the vector into cells by electroporation.

4. Single Cell Clone Screening and Culture

5. PCR and Electrophoresis Identification

Identification Strategy:

6. Sequencing Identification

ATAAACAGAGGATTTAAGACTTTTGTTATGTTTTAGACGC-del；
1809bp--AGTGGCTAATGCCT GTAATCC CACCACTTTGGGAGGCCAA

It is well known that cell lines play an important role in gene function studies, drug screening, and the production of recombinant proteins and antibodies. However, generating a gene knockout cell line model is a time-consuming and laborious process. Partnering with Cyagen for your cell line model projects ensures that your research model is developed appropriately.

• Knockout Cell Lines

  We can perform a variety of knockout (KO) strategies to generate a custom cell line model, including frameshift mutation, large fragment knockout (LFKO), and multiple genes knockout to optimize the success rate of targeted gene knockout. Compared with traditional gene interference (RNAi) technology, gene knockout (KO) models allow researchers to fully disrupt expression of the target gene, ultimately leading to either complete non-expression or loss of function in proteins. Gene knockout (KO) cell lines enable researchers to study the role of specific genes by comparing the phenotypic differences among the knockout and wildtype cells.

  >> Learn More
• Knockin Cell Lines

  Knockin defined as an exogenous gene inserted in a native locus of interest. A double stranded break is introduced by Targeted Gene Editing-Cas9 to a specific site in the genome. Via homology-directed repair pathway, the donor sequence alone with homologous arms can be introduced into that locus. Targeted Gene Editing-Pro technology enables large fragment knockin in variety of mammalian cell lines.

  >> Learn More
• Point Mutation Cell Lines

  Point mutation defined as one or more nucleotides are mutated. The insertion, deletion, nonsense and sense mutations alter the amino acid sequence, thus changing its functions or properties of a given protein. Point mutation knockin cell lines enable a clear understanding of the contribution of the mutation to a phenotype.

  >> Learn More
• Overexpression Cell Lines

  Stable cell lines are crucial laboratory tools. Gene overexpression, inducible gene expression, gene knockout, gene knockdown all can be achieved by custom lentiviral-based stable cell line service.

  >> Learn More

• Cell Function Testing

  Cyagen provides various cell function testing services, including transwell invasion, cell migration, cell cycle, cell proliferation, cell apoptosis, and other cell detection assays that can be realized by the flow cytometry platform. We assure the standardization, accuracy, and reliability across the entire process, from strategy design through sample preparation and data analysis.

  >> Learn More

• 
  Cyagen Exclusive White Paper

  Application of Targeted Gene Editing/Cas-based Technology to Create Knockout Cell Lines

  Download Your Copy >>
• 
  Exclusive Handbook

  Frequently Asked Questions on Cell Line Generation

  Download Your Copy >>
• 
  Technical Bulletin

  What are Knockout Cell Lines Used For?

  Discover More >>
• 
  Technical Bulletin

  How to Effectively Generate Targeted Gene Editing Gene Knockout Cell Lines? Choosing a Transfection Method

  Discover More >>